Difference between revisions of "LH/CG Receptor"

From MagnetoWiki
Jump to navigation Jump to search
(created)
 
(added antisera)
 
(4 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
Luteinizing hormone/choriogonadotropin receptor (Lhcgr)
 
Luteinizing hormone/choriogonadotropin receptor (Lhcgr)
 +
Entrez gene: 25477
  
  
Line 7: Line 8:
  
 
LOCUS NM_012978, 2902 bp, mRNA   
 
LOCUS NM_012978, 2902 bp, mRNA   
 +
 +
[http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds
 +
 +
LOCUS RATLHHCG,  2902 bp    mRNA
 +
 +
McFarland et al., Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family, Science 245 (4917), 494-499 (1989) PMID 2502842
  
 
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
 
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
Line 13: Line 20:
  
 
Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640
 
Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640
−
 
−
 
  
 
==Blast Results==
 
==Blast Results==
Line 27: Line 32:
  
 
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
 
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
 +
 +
==UCSC Genome Browser Results==
 +
 +
2011-9-16
 +
 +
Searched for lhcgr gene in Feb 2008 GP genome
 +
 +
mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1
 +
 +
[http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)]
 +
 +
 +
Blasted predicted RNA sequence of  scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic scaffold, RGSC_v3.4., which contains LH/CGR precursor
 +
 +
==Primer Design==
 +
 +
Used rat Lhcgr NM_012978 coding region (bases 44-2146) into [http://frodo.wi.mit.edu/primer3/ Primer 3 v. 0.4.0] for products 800-1000 bp
 +
 +
<tab sep=tab border=1 head=top>
 +
ID Primer Tm
 +
LHFOR510 gaatgctttccaagggatga 60
 +
LHRFOR960 ttattccgccatctttgagg 60
 +
LHFOR1018 tgttcacccaagacactcca 60
 +
LHREV1426 cagcataggtgatggtgtgc 60
 +
LHREV1786 ccgagatggcaaagaaagag 60
 +
LHRREV1872 tggattggcacaagaattga 60
 +
LHRREV1910 tctctctgaaacgccttcgt 60
 +
</tab>
 +
 +
 +
Primers from Apaja et al. 2004 PMID 14581462 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
 +
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
 +
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag
 +
 +
==Antisera for IHC==
 +
 +
Rabbit Polyclonal Santa Cruz LHR (H-50): sc-25828 [http://www.scbt.com/datasheet-25828-lhr-h-50-antibody.html sc-25828]
 +
 +
"recommended for detection of LHR of mouse, rat and human origin by WB, IP, IF, IHC(P) and ELISA"
 +
 +
Santa Cruz also has several goat anti-LHR antibodies, but not sure they work for IHC (although listed for immunofluroescence).

Latest revision as of 13:01, 6 October 2011

Luteinizing hormone/choriogonadotropin receptor (Lhcgr) Entrez gene: 25477


Rat LH/CG Receptor sequences

NM_012978.1 Rattus norvegicus luteinizing hormone/choriogonadotropin receptor (Lhcgr), mRNA.

LOCUS NM_012978, 2902 bp, mRNA

M26199 Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds

LOCUS RATLHHCG, 2902 bp mRNA

McFarland et al., Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family, Science 245 (4917), 494-499 (1989) PMID 2502842

AH004953 Rattus norvegicus luteinizing hormone receptor gene, partial cds

LOCUS SEG_RATLHHCG0, 8163 bp, DNA

Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640

Blast Results

2011-9-7

Genomic Blast of NM012978.1 against the Cavia porcellus genome:

Good match to 1117 bp stretch (bp 13550 - 12442) of gb|AAKN02023989.1| Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence,

Genomic Blast of AH004953.2 against the Cavia porcellus genome:

Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence

UCSC Genome Browser Results

2011-9-16

Searched for lhcgr gene in Feb 2008 GP genome

mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1

N-SCAN Gene Predictions (scaffold_18.245.1)


Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic scaffold, RGSC_v3.4., which contains LH/CGR precursor

Primer Design

Used rat Lhcgr NM_012978 coding region (bases 44-2146) into Primer 3 v. 0.4.0 for products 800-1000 bp

ID Primer Tm
LHFOR510 gaatgctttccaagggatga 60
LHRFOR960 ttattccgccatctttgagg 60
LHFOR1018 tgttcacccaagacactcca 60
LHREV1426 cagcataggtgatggtgtgc 60
LHREV1786 ccgagatggcaaagaaagag 60
LHRREV1872 tggattggcacaagaattga 60
LHRREV1910 tctctctgaaacgccttcgt 60


Primers from Apaja et al. 2004 PMID 14581462 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)

LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
LHRREV2116 ctgttgacagtgcactgtggacaacttcag

Antisera for IHC

Rabbit Polyclonal Santa Cruz LHR (H-50): sc-25828 sc-25828

"recommended for detection of LHR of mouse, rat and human origin by WB, IP, IF, IHC(P) and ELISA"

Santa Cruz also has several goat anti-LHR antibodies, but not sure they work for IHC (although listed for immunofluroescence).

Retrieved from "https://wiki.houptlab.org/index.php?title=LH/CG_Receptor&oldid=2297"