Difference between revisions of "Serotonin Genes"

From MagnetoWiki
Jump to navigation Jump to search
(listed TPH2 primers)
 
(Archived Protos link because site has been taken over by link-farm like search site. Company is probably dead.)
 
(12 intermediate revisions by one other user not shown)
Line 1: Line 1:
 +
I am interested in 4 of the genes related to serotonin function in depression and food intake: Pet-1, Serotonin Transporter (5HTT), Tryptophan Hydroxylase 2 (TPH2), and 5HT2C Receptor (5HT2CR)
  
 +
= ISH probes=
  
I am interested in 4 of the genes related to serotonin function in depression and food intake:
+
==Pet-1==
  
Pet-1
 
  
Serotonin Transporter
+
Reference:
  
Tryptophan Hydroxylase 2
+
==Serotonin Transporter==
  
5HT2C Receptor
 
  
 +
Reference:
 +
 +
 +
==Tryptophan Hydroxylase 2==
 +
 +
 +
(see PCR primers below).
 +
 +
 +
Reference: Kulikov AV, Osipova DV, Naumenko VS, Popova NK. Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav. 2005 Nov;4(8):482-5. PMID 16268992
 +
 +
==5HT2C Receptor==
 +
 +
(see PCR primers below)
 +
 +
Was originally called the 5HT1C receptor when first discovered.
 +
 +
References:
 +
 +
Molineaux SM, Jessell TM, Axel R, Julius D.  5-HT1c receptor is a prominent serotonin receptor subtype in the central nervous system. Proc Natl Acad Sci U S A. 1989 Sep;86(17):6793-7. PMID 2771958 Very nice in situ usinga  300 bp riboprobe. The sequence was taken from Julius et al 1988
 +
 +
Julius D, MacDermott AB, Axel R, Jessell TM. Molecular characterization of a functional cDNA encoding the serotonin 1c receptor. Science. 1988 Jul 29;241(4865):558-64. PMID: 339989
  
 
=PCR primers=
 
=PCR primers=
  
Tryptophan Hydroxylase 2 cDNA for in situ hybridization
+
==Tryptophan Hydroxylase 2 cDNA==
 +
 
 +
for in situ hybridization
 +
 
 +
product size: 
 +
 
 +
495 bp product corresponding to bases 319-813 of AY098915 (from Malek PMID 16115212).
 +
 
 +
502 bp product corresponding to bases 312-814 of NM173839 (based on our lookup)
 +
 
 +
Verified by sequencing on 2-12-09; RT-PCR product sequenced with for and rev primers matched  bases 366-769 of AY098915.
 +
 
 +
:TPH2for  base 312-334:
 +
 
 +
::5’ -GAAGTTGGCGGGCTGGTGAGA–3’
 +
 
 +
:TPH2rev:bases 791-814
 +
 
 +
::5’ -TCGGCAAGCATGAGTGGGGTAGA–3’
  
product size:  bp, range & ascension number?
 
  
TPH2for GAAGTTGGCGGGCTGGTGAGA 21 bases
+
Reference:
TPH2rev TCGGCAAGCATGAGTGGGGTAGA 23 bases
+
Malek ZS, Dardente H, Pevet P, Raison S. Tissue-specific expression of tryptophan hydroxylase mRNAs in the rat midbrain: anatomical evidence and daily profiles. Eur J Neurosci. 2005 Aug;22(4):895-901. PMID 16115212
  
Reference: Kulikov AV, Osipova DV, Naumenko VS, Popova NK. Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav. 2005 Nov;4(8):482-5. PMID 16268992
+
==Tryptophan Hydroxylase 2 polymorphisms==
  
Tryptophan Hydroxylase 2 polymorphism linked to aggression
+
linked to aggression.  5 min at 94°C then 40 cycles (30 s at 94°C, 30 s at 60°C, 30 s at 72°C)
  
 
Positive control, product size 523 bp
 
Positive control, product size 523 bp
ctrlTPH2for: 5’ -tttgacccaaagacgacctgcttgca –3’
 
ctrlTPH2rev: 5’-tgcatgcttactagccaaccatgagaca-3’
 
  
1473C allele: 307bp
+
:ctrlTPH2for: 5’ -tttgacccaaagacgacctgcttgca –3’
 +
 
 +
:ctrlTPH2rev: 5’-tgcatgcttactagccaaccatgagaca-3’
 +
 
 +
:1473C allele, product size 307bp
 +
 
 
TPH2C1473: 5’-cagaatttcaatgctctgcgtgtggg-3’
 
TPH2C1473: 5’-cagaatttcaatgctctgcgtgtggg-3’
  
1473G allele : 307 bp
+
:1473G allele. product size 307 bp
 +
 
 
TPH2g1473: 5’-cagaatttcaatgctctgcgtgtggc-3’
 
TPH2g1473: 5’-cagaatttcaatgctctgcgtgtggc-3’
 +
 +
Mouse accession number: NM_173391
 +
Rat accession Number: NM_173839
  
 
Reference:  Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG. Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science. 2004 Jul 9;305(5681):217. PMID 15247473
 
Reference:  Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG. Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science. 2004 Jul 9;305(5681):217. PMID 15247473
 +
 +
==5HT2C Receptor cDNA==
 +
 +
for in situ hybridization
 +
 +
product size:  207  bp, ascension number: M21410, bp 105-311
 +
 +
:5HT2Cfor (bp 105-126):   5’ -CTATCCCTTACCTTCCTATTAC–3’
 +
 +
:5HT2Crev (bp 311-290):  5’ -TACCCTACTCTAGCATAGAAAC–3’
 +
 +
References:
 +
 +
Heisler LK, Pronchuk N, Nonogaki K, Zhou L, Raber J, Tung L, Yeo GS, O'Rahilly S, Colmers WF, Elmquist JK, Tecott LH.
 +
Serotonin activates the hypothalamic-pituitary-adrenal axis via serotonin 2C receptor stimulation.
 +
J Neurosci. 2007 Jun 27;27(26):6956-64.
 +
PMID 17596444
 +
 +
 +
Molineaux SM, Jessell TM, Axel R, Julius D.
 +
5-HT1c receptor is a prominent serotonin receptor subtype in the central nervous system.
 +
Proc Natl Acad Sci U S A. 1989 Sep;86(17):6793-7.
 +
PMID 2771958
 +
 +
Julius,D., MacDermott,A.B., Axel,R. and Jessell,T.M. Molecular characterization of a functional cDNA encoding the serotonin 1c receptor, Science 241 (4865), 558-564 (1988) PMID 3399891
 +
 +
 +
=Antisera for IHC=
 +
NT-102 5HTrab rabbit serotonin antisera
 +
 +
[https://web.archive.org/web/20180820082755/http://www.protosantibody.com/ PROTOS BIOTECH CORP] (Archive link)
 +
PBTantibody Division
 +
315 E. 65th Street, Suit 4K, New York, New York 10065
 +
1-212-517-6801
 +
1-212-772-1514 (fax)
 +
PBTantibody@verizon.net
 +
 +
[[Category:Depression]]
 +
[[Category:Ingestive Behavior]]

Latest revision as of 13:13, 12 March 2019

I am interested in 4 of the genes related to serotonin function in depression and food intake: Pet-1, Serotonin Transporter (5HTT), Tryptophan Hydroxylase 2 (TPH2), and 5HT2C Receptor (5HT2CR)

ISH probes

Pet-1

Reference:

Serotonin Transporter

Reference:


Tryptophan Hydroxylase 2

(see PCR primers below).


Reference: Kulikov AV, Osipova DV, Naumenko VS, Popova NK. Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav. 2005 Nov;4(8):482-5. PMID 16268992

5HT2C Receptor

(see PCR primers below)

Was originally called the 5HT1C receptor when first discovered.

References:

Molineaux SM, Jessell TM, Axel R, Julius D. 5-HT1c receptor is a prominent serotonin receptor subtype in the central nervous system. Proc Natl Acad Sci U S A. 1989 Sep;86(17):6793-7. PMID 2771958 Very nice in situ usinga 300 bp riboprobe. The sequence was taken from Julius et al 1988

Julius D, MacDermott AB, Axel R, Jessell TM. Molecular characterization of a functional cDNA encoding the serotonin 1c receptor. Science. 1988 Jul 29;241(4865):558-64. PMID: 339989

PCR primers

Tryptophan Hydroxylase 2 cDNA

for in situ hybridization

product size:

495 bp product corresponding to bases 319-813 of AY098915 (from Malek PMID 16115212).

502 bp product corresponding to bases 312-814 of NM173839 (based on our lookup)

Verified by sequencing on 2-12-09; RT-PCR product sequenced with for and rev primers matched bases 366-769 of AY098915.

TPH2for base 312-334:
5’ -GAAGTTGGCGGGCTGGTGAGA–3’
TPH2rev:bases 791-814
5’ -TCGGCAAGCATGAGTGGGGTAGA–3’


Reference: Malek ZS, Dardente H, Pevet P, Raison S. Tissue-specific expression of tryptophan hydroxylase mRNAs in the rat midbrain: anatomical evidence and daily profiles. Eur J Neurosci. 2005 Aug;22(4):895-901. PMID 16115212

Tryptophan Hydroxylase 2 polymorphisms

linked to aggression. 5 min at 94°C then 40 cycles (30 s at 94°C, 30 s at 60°C, 30 s at 72°C)

Positive control, product size 523 bp

ctrlTPH2for: 5’ -tttgacccaaagacgacctgcttgca –3’
ctrlTPH2rev: 5’-tgcatgcttactagccaaccatgagaca-3’
1473C allele, product size 307bp

TPH2C1473: 5’-cagaatttcaatgctctgcgtgtggg-3’

1473G allele. product size 307 bp

TPH2g1473: 5’-cagaatttcaatgctctgcgtgtggc-3’

Mouse accession number: NM_173391 Rat accession Number: NM_173839

Reference: Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG. Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science. 2004 Jul 9;305(5681):217. PMID 15247473

5HT2C Receptor cDNA

for in situ hybridization

product size: 207 bp, ascension number: M21410, bp 105-311

5HT2Cfor (bp 105-126): 5’ -CTATCCCTTACCTTCCTATTAC–3’
5HT2Crev (bp 311-290): 5’ -TACCCTACTCTAGCATAGAAAC–3’

References:

Heisler LK, Pronchuk N, Nonogaki K, Zhou L, Raber J, Tung L, Yeo GS, O'Rahilly S, Colmers WF, Elmquist JK, Tecott LH. Serotonin activates the hypothalamic-pituitary-adrenal axis via serotonin 2C receptor stimulation. J Neurosci. 2007 Jun 27;27(26):6956-64. PMID 17596444


Molineaux SM, Jessell TM, Axel R, Julius D. 5-HT1c receptor is a prominent serotonin receptor subtype in the central nervous system. Proc Natl Acad Sci U S A. 1989 Sep;86(17):6793-7. PMID 2771958

Julius,D., MacDermott,A.B., Axel,R. and Jessell,T.M. Molecular characterization of a functional cDNA encoding the serotonin 1c receptor, Science 241 (4865), 558-564 (1988) PMID 3399891


Antisera for IHC

NT-102 5HTrab rabbit serotonin antisera

PROTOS BIOTECH CORP (Archive link) PBTantibody Division 315 E. 65th Street, Suit 4K, New York, New York 10065 1-212-517-6801 1-212-772-1514 (fax) PBTantibody@verizon.net