Difference between revisions of "LH/CG Receptor"
(added antisera) |
|||
(3 intermediate revisions by the same user not shown) | |||
Line 10: | Line 10: | ||
[http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds | [http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds | ||
+ | |||
+ | LOCUS RATLHHCG, 2902 bp mRNA | ||
+ | |||
+ | McFarland et al., Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family, Science 245 (4917), 494-499 (1989) PMID 2502842 | ||
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds | [http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds | ||
Line 16: | Line 20: | ||
Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640 | Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640 | ||
− | |||
− | |||
==Blast Results== | ==Blast Results== | ||
Line 40: | Line 42: | ||
[http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)] | [http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)] | ||
− | |||
− | Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic | + | |
− | + | Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic scaffold, RGSC_v3.4., which contains LH/CGR precursor | |
==Primer Design== | ==Primer Design== | ||
Line 61: | Line 62: | ||
− | Primers from Apaja et al. | + | Primers from Apaja et al. 2004 PMID 14581462 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding) |
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg | :LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg | ||
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag | :LHRREV2116 ctgttgacagtgcactgtggacaacttcag | ||
+ | |||
+ | ==Antisera for IHC== | ||
+ | |||
+ | Rabbit Polyclonal Santa Cruz LHR (H-50): sc-25828 [http://www.scbt.com/datasheet-25828-lhr-h-50-antibody.html sc-25828] | ||
+ | |||
+ | "recommended for detection of LHR of mouse, rat and human origin by WB, IP, IF, IHC(P) and ELISA" | ||
+ | |||
+ | Santa Cruz also has several goat anti-LHR antibodies, but not sure they work for IHC (although listed for immunofluroescence). |
Latest revision as of 13:01, 6 October 2011
Luteinizing hormone/choriogonadotropin receptor (Lhcgr) Entrez gene: 25477
Rat LH/CG Receptor sequences
NM_012978.1 Rattus norvegicus luteinizing hormone/choriogonadotropin receptor (Lhcgr), mRNA.
LOCUS NM_012978, 2902 bp, mRNA
M26199 Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds
LOCUS RATLHHCG, 2902 bp mRNA
McFarland et al., Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family, Science 245 (4917), 494-499 (1989) PMID 2502842
AH004953 Rattus norvegicus luteinizing hormone receptor gene, partial cds
LOCUS SEG_RATLHHCG0, 8163 bp, DNA
Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640
Blast Results
2011-9-7
Genomic Blast of NM012978.1 against the Cavia porcellus genome:
Good match to 1117 bp stretch (bp 13550 - 12442) of gb|AAKN02023989.1| Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence,
Genomic Blast of AH004953.2 against the Cavia porcellus genome:
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
UCSC Genome Browser Results
2011-9-16
Searched for lhcgr gene in Feb 2008 GP genome
mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1
N-SCAN Gene Predictions (scaffold_18.245.1)
Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic scaffold, RGSC_v3.4., which contains LH/CGR precursor
Primer Design
Used rat Lhcgr NM_012978 coding region (bases 44-2146) into Primer 3 v. 0.4.0 for products 800-1000 bp
ID | Primer | Tm |
---|---|---|
LHFOR510 | gaatgctttccaagggatga | 60 |
LHRFOR960 | ttattccgccatctttgagg | 60 |
LHFOR1018 | tgttcacccaagacactcca | 60 |
LHREV1426 | cagcataggtgatggtgtgc | 60 |
LHREV1786 | ccgagatggcaaagaaagag | 60 |
LHRREV1872 | tggattggcacaagaattga | 60 |
LHRREV1910 | tctctctgaaacgccttcgt | 60 |
Primers from Apaja et al. 2004 PMID 14581462 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
- LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
- LHRREV2116 ctgttgacagtgcactgtggacaacttcag
Antisera for IHC
Rabbit Polyclonal Santa Cruz LHR (H-50): sc-25828 sc-25828
"recommended for detection of LHR of mouse, rat and human origin by WB, IP, IF, IHC(P) and ELISA"
Santa Cruz also has several goat anti-LHR antibodies, but not sure they work for IHC (although listed for immunofluroescence).