Difference between revisions of "LH/CG Receptor"
(created) |
|||
| Line 1: | Line 1: | ||
Luteinizing hormone/choriogonadotropin receptor (Lhcgr) | Luteinizing hormone/choriogonadotropin receptor (Lhcgr) | ||
| + | Entrez gene: 25477 | ||
| Line 7: | Line 8: | ||
LOCUS NM_012978, 2902 bp, mRNA | LOCUS NM_012978, 2902 bp, mRNA | ||
| + | |||
| + | [http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds | ||
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds | [http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds | ||
| Line 27: | Line 30: | ||
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence | Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence | ||
| + | |||
| + | ==UCSC Genome Browser Results== | ||
| + | |||
| + | 2011-9-16 | ||
| + | |||
| + | Searched for lhcgr gene in Feb 2008 GP genome | ||
| + | |||
| + | mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1 | ||
| + | |||
| + | [http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)] | ||
| + | ] | ||
| + | |||
| + | Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic | ||
| + | scaffold, RGSC_v3.4., which contains LH/CGR precursor | ||
| + | |||
| + | ==Primer Design== | ||
| + | |||
| + | Used rat Lhcgr NM_012978 coding region (bases 44-2146) into [http://frodo.wi.mit.edu/primer3/ Primer 3 v. 0.4.0] for products 800-1000 bp | ||
| + | |||
| + | <tab sep=tab border=1 head=top> | ||
| + | ID Primer Tm | ||
| + | LHFOR510 gaatgctttccaagggatga 60 | ||
| + | LHRFOR960 ttattccgccatctttgagg 60 | ||
| + | LHFOR1018 tgttcacccaagacactcca 60 | ||
| + | LHREV1426 cagcataggtgatggtgtgc 60 | ||
| + | LHREV1786 ccgagatggcaaagaaagag 60 | ||
| + | LHRREV1872 tggattggcacaagaattga 60 | ||
| + | LHRREV1910 tctctctgaaacgccttcgt 60 | ||
| + | </tab> | ||
| + | |||
| + | |||
| + | Primers from Apaja et al. 2003 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding) | ||
| + | :LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg | ||
| + | :LHRREV2116 ctgttgacagtgcactgtggacaacttcag | ||
Revision as of 10:18, 16 September 2011
Luteinizing hormone/choriogonadotropin receptor (Lhcgr) Entrez gene: 25477
Rat LH/CG Receptor sequences
NM_012978.1 Rattus norvegicus luteinizing hormone/choriogonadotropin receptor (Lhcgr), mRNA.
LOCUS NM_012978, 2902 bp, mRNA
M26199 Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds
AH004953 Rattus norvegicus luteinizing hormone receptor gene, partial cds
LOCUS SEG_RATLHHCG0, 8163 bp, DNA
Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640
Blast Results
2011-9-7
Genomic Blast of NM012978.1 against the Cavia porcellus genome:
Good match to 1117 bp stretch (bp 13550 - 12442) of gb|AAKN02023989.1| Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence,
Genomic Blast of AH004953.2 against the Cavia porcellus genome:
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
UCSC Genome Browser Results
2011-9-16
Searched for lhcgr gene in Feb 2008 GP genome
mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1
N-SCAN Gene Predictions (scaffold_18.245.1) ]
Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic
scaffold, RGSC_v3.4., which contains LH/CGR precursor
Primer Design
Used rat Lhcgr NM_012978 coding region (bases 44-2146) into Primer 3 v. 0.4.0 for products 800-1000 bp
| ID | Primer | Tm |
|---|---|---|
| LHFOR510 | gaatgctttccaagggatga | 60 |
| LHRFOR960 | ttattccgccatctttgagg | 60 |
| LHFOR1018 | tgttcacccaagacactcca | 60 |
| LHREV1426 | cagcataggtgatggtgtgc | 60 |
| LHREV1786 | ccgagatggcaaagaaagag | 60 |
| LHRREV1872 | tggattggcacaagaattga | 60 |
| LHRREV1910 | tctctctgaaacgccttcgt | 60 |
Primers from Apaja et al. 2003 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
- LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
- LHRREV2116 ctgttgacagtgcactgtggacaacttcag