Changes

14 bytes added ,  12:51, 6 October 2011
→‎Primer Design: fixed reference
Line 62: Line 62:       −
Primers from Apaja et al. 2003 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
+
Primers from Apaja et al. 2004 PMID 14581462 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
 
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
 
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
 
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag
 
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag