Difference between revisions of "LH/CG Receptor"

From MagnetoWiki
Jump to navigation Jump to search
(→‎Primer Design: fixed reference)
Line 62: Line 62:
  
  
Primers from Apaja et al. 2003 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
+
Primers from Apaja et al. 2004 PMID 14581462 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
 
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
 
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
 
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag
 
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag

Revision as of 13:51, 6 October 2011

Luteinizing hormone/choriogonadotropin receptor (Lhcgr) Entrez gene: 25477


Rat LH/CG Receptor sequences

NM_012978.1 Rattus norvegicus luteinizing hormone/choriogonadotropin receptor (Lhcgr), mRNA.

LOCUS NM_012978, 2902 bp, mRNA

M26199 Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds

LOCUS RATLHHCG, 2902 bp mRNA

McFarland et al., Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family, Science 245 (4917), 494-499 (1989) PMID 2502842

AH004953 Rattus norvegicus luteinizing hormone receptor gene, partial cds

LOCUS SEG_RATLHHCG0, 8163 bp, DNA

Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640

Blast Results

2011-9-7

Genomic Blast of NM012978.1 against the Cavia porcellus genome:

Good match to 1117 bp stretch (bp 13550 - 12442) of gb|AAKN02023989.1| Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence,

Genomic Blast of AH004953.2 against the Cavia porcellus genome:

Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence

UCSC Genome Browser Results

2011-9-16

Searched for lhcgr gene in Feb 2008 GP genome

mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1

N-SCAN Gene Predictions (scaffold_18.245.1)


Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic scaffold, RGSC_v3.4., which contains LH/CGR precursor

Primer Design

Used rat Lhcgr NM_012978 coding region (bases 44-2146) into Primer 3 v. 0.4.0 for products 800-1000 bp

ID Primer Tm
LHFOR510 gaatgctttccaagggatga 60
LHRFOR960 ttattccgccatctttgagg 60
LHFOR1018 tgttcacccaagacactcca 60
LHREV1426 cagcataggtgatggtgtgc 60
LHREV1786 ccgagatggcaaagaaagag 60
LHRREV1872 tggattggcacaagaattga 60
LHRREV1910 tctctctgaaacgccttcgt 60


Primers from Apaja et al. 2004 PMID 14581462 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)

LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
LHRREV2116 ctgttgacagtgcactgtggacaacttcag