1,044
edits
Changes
added antisera
[http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds
[http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds
LOCUS RATLHHCG, 2902 bp mRNA
McFarland et al., Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family, Science 245 (4917), 494-499 (1989) PMID 2502842
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640
Tsai-Morris et al., Structural organization of the rat luteinizing hormone (LH) receptor gene J. Biol. Chem. 266 (17), 11355-11359 (1991) PMID 2040640
==Blast Results==
==Blast Results==
[http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)]
[http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)]
Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic
Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic scaffold, RGSC_v3.4., which contains LH/CGR precursor
==Primer Design==
==Primer Design==
Primers from Apaja et al. 2003 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
Primers from Apaja et al. 2004 PMID 14581462 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag
==Antisera for IHC==
Rabbit Polyclonal Santa Cruz LHR (H-50): sc-25828 [http://www.scbt.com/datasheet-25828-lhr-h-50-antibody.html sc-25828]
"recommended for detection of LHR of mouse, rat and human origin by WB, IP, IF, IHC(P) and ELISA"
Santa Cruz also has several goat anti-LHR antibodies, but not sure they work for IHC (although listed for immunofluroescence).