NMDA Receptors
Jump to navigation
Jump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
Primers for Davenport's Real-Time PCR experiment
Primers were ordered 2009 May from Sigma Aldrich
(designed using PrimerPlus3)
Probe Abbr Sequence Tm Size Genbank Reference |
---|
Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus |
QNR1REV atggacagggaaacgttctg 60.0 |
Rat Serine Racemase QSERRACFOR tggtagatgcgttggtggta 60.0 103 NM_198757, 856-958 PrimerPlus |
QSERRACREV tcagcagcgtacaccttcac 60.1 |
Rat GADPH QGADPHFOR tcactgccactcagaagactg 60 123 DQ403053, 467-589 Andre designed with sequencher |
QGADPHREV ggatgaccttgcccacagc 60 . . . |
Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).
Probe Abbr Sequence Tm Size Genbank Reference |
---|
NR1 RTNR1FOR GTTCTTCCGCTCAGGCTTTG 66.0 66 RNU11418, 2396-2461 Yamamoto et al. 2008 PMID 17957211 |
RTNR1REV AGGGAAACGTTCTGCTTCCA 65.8 |
Serine Racemase RTSERRACFOR ATTGCAAGAAACTGGCCATC 63.9 295 NM198757, 664-958 Yoshikawa et al., 2006 PMID 16973158 |
RTSERRACREV TCAGCAGCGTACACCTTCAC 64.1 |
GADPH RTGADPHFOR TGCACCACCAACTGCTTAG 62.5 201 DQ403053.1, 397-597 Uno et al., 2002 PMID 12068078 |
RTGADPHREV GGATGCAGGGATGATGTTC 63.0 |
Note: GADPHFOR and REV maybe mixed up . . . . |
Primers for Real-Time PCR
Looked at primers from Yamamoto et al. 2008 PMID 17957211 using Applied Biosystems, but ended up designing own primers above.