TORC

Description

TORC proteins (Transducer of Regulated CREB activity, aka CREB-regulated transcription coactivators or CRTCs) are a family of 3 highly-conserved human genes identified in high-throughput screens of cDNAs that activated the IL-8 promoter {Iourgenko, 2003 #1935} or a CRE-containing reporter construct {Conkright, 2003 #1936}. All 3 TORCs are expressed in the brain, with highest expression of TORC1 {Altarejos, 2008 #1938}. TORCs do not bind DNA directly, but are CREB co-activators that enhance CRE-regulated transcription after binding CREB and recruiting TFIID {Iourgenko, 2003 #1935}{Conkright, 2003 #1936}.

Phosphorylation of CREB at S133 by PKA and binding of TORC to CREB can independently {Xu, 2007 #1943} or additively {Conkright, 2003 #1936} act at the CRE to enhance expression. Thus, full activation of CREB-mediated transcription requires the nuclear translocation of both catalytic PKA and TORC. Phosphorylated TORC (pTORC) is sequestered in the cytoplasm by binding to the scaffolding protein 14-3-3. TORC dephosphorylation by Ca++-activated CaN (or by PKA-mediated inhibition of the AMPK family kinases that phosphorylate TORC) causes the release of TORC from 14-3-3 and its translocation to the nucleus {Spencer, 2010 #1946}.

TORCs have been implicated in several CREB-regulated processes, including gluconeogenesis {Koo, 2005 #1941}, tumor induction {Conkright, 2003 #1936}{Amelio, 2009 #1942}, CRH expression {Liu, 2010 #1940}, long-term potentiation {Kovacs, 2007 #1945}, hypothalamic responses to metabolic deficits {Altarejos, 2008 #1938}, and cocaine self-administration {Hollander, 2010 #1939}.

Antisera from Cell Signaling

Torc1 (C71D11) Rabbit mAb #2587 $225 http://www.cellsignal.com/products/2587.html (Dilution of 1:1000 looks best in our hands).

Torc2 Antibody #3826 $214 (polyclonal, not tested in rat?) http://www.cellsignal.com/products/3826.html

Torc3 (C35G4) Rabbit mAb #2720 $214 http://www.cellsignal.com/products/2720.html

We'll also need this mouse version of anti-pCREB for double labeling:

Phospho-CREB (Ser133) (1B6) Mouse mAb #9196S $235 http://www.cellsignal.com/products/9196.html

Torc related PCR primers

From Li et al PMID 19244510

PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp.

WORKED WELL at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.

Rat SIK1 from Kanyo et al PMID 19470703

Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.

DID NOT WORK IN OUR HANDS at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.

Rat SIK2 primers based on Mouse SIK2 from Horike PMID 12624099

forward primer: CATGGTCATGGCGGATGGCCCGAGGCA ( rat DQ188032.1 bp45-71) and reverse: CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC (mouse 178710.3 bp 2941-2994) Predicted product 2449 bp.

DID NOT WORK IN OUR HANDS AT: at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.

Other SIK primers Not Used

Rat SIK1 from Lin et al PMID 11463852

(NOT USED) SIK cDNA fragments were amplified by PCR from a rat adrenal zona glomerulosa cDNA library (15) by using the following sets of primer, sense: 5′-gcggccgcATGGTGATCATGTCGGAGTTC and antisense1: 5′-gaattcTCACTGTACCAGGACGAACGTCC, or sense and antisense2: 5′-gaattcCTGTACCAGGACGAACGTCCC (the lowercase letters indicate the linker sequences). The amplified products were introduced into pT7(R) vector (Novagen), the resultant plasmids being named pT7-SIK and pT7-SIK(-stop),

Mouse SIK1 from Horike et al PMID 12624099

(NOT USED) a 3′ non-coding region of mouse SIK1 cDNA was amplified by PCR by using primers, 5′-TTGCTCATGCCTGTGTAGTG and 5′-TTCGCCTGTCTGGAGAGTAA.

Mouse SIK2 from Horike et al PMID 12624099

(NOT USED) Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).

Wang et al 1999 PMID 10403390

First paper cloning SIK (SIK I?) from rat adrenal cortex 5'-ATGGTGATCATGTCGGAGTTC-3′ , 5'-TTATCATTGAGGTCCTCAG-3′ product 2.4 Kb