Difference between revisions of "NMDA Receptors"
Jump to navigation
Jump to search
(added GADPH genbank info) |
(Fix table to use tabs.) |
||
| (One intermediate revision by the same user not shown) | |||
| Line 3: | Line 3: | ||
Primers were ordered 2009 May from Sigma Aldrich | Primers were ordered 2009 May from Sigma Aldrich | ||
| − | (designed using [ | + | (designed using [https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi PrimerPlus3]) |
| − | <tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top> | + | <tab class="wikitable" sep=tab border = "1" cellspacing="3" cellpadding = "3" head = top> |
Probe Abbr Sequence Tm Size Genbank Reference | Probe Abbr Sequence Tm Size Genbank Reference | ||
Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus | Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus | ||
| Line 21: | Line 21: | ||
Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above). | Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above). | ||
| − | <tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top> | + | <tab class="wikitable" sep=tab border = "1" cellspacing="3" cellpadding = "3" head = top> |
Probe Abbr Sequence Tm Size Genbank Reference | Probe Abbr Sequence Tm Size Genbank Reference | ||
NR1 RTNR1FOR GTTCTTCCGCTCAGGCTTTG 66.0 66 RNU11418, 2396-2461 Yamamoto et al. 2008 PMID 17957211 | NR1 RTNR1FOR GTTCTTCCGCTCAGGCTTTG 66.0 66 RNU11418, 2396-2461 Yamamoto et al. 2008 PMID 17957211 | ||
Latest revision as of 15:17, 4 July 2022
Primers for Davenport's Real-Time PCR experiment
Primers were ordered 2009 May from Sigma Aldrich
(designed using PrimerPlus3)
| Probe | Abbr | Sequence | Tm | Size | Genbank | -Reference |
|---|---|---|---|---|---|---|
| Rat NR1 subunit | QNR1FOR | ttcacagaagtgcgatctgg | 60.0 | 108 | U11418.1,2360-2467 | PrimerPlus |
| QNR1REV | atggacagggaaacgttctg | 60.0 | ||||
| Rat Serine Racemase | QSERRACFOR | tggtagatgcgttggtggta | 60.0 | 103 | NM_198757, 856-958 | PrimerPlus |
| QSERRACREV | tcagcagcgtacaccttcac | 60.1 | ||||
| Rat GADPH | QGADPHFOR | tcactgccactcagaagactg | 60 | 123 | DQ403053, 467-589 | Andre designed with sequencher |
| QGADPHREV | ggatgaccttgcccacagc | 60 | . | . | . |
Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).
| Probe | Abbr | Sequence | Tm | Size | Genbank | -Reference |
|---|---|---|---|---|---|---|
| NR1 | RTNR1FOR | GTTCTTCCGCTCAGGCTTTG | 66.0 | 66 | RNU11418, 2396-2461 | Yamamoto et al. 2008 PMID 17957211 |
| RTNR1REV | AGGGAAACGTTCTGCTTCCA | 65.8 | ||||
| Serine Racemase | RTSERRACFOR | ATTGCAAGAAACTGGCCATC | 63.9 | 295 | NM198757, 664-958 | Yoshikawa et al., 2006 PMID 16973158 |
| RTSERRACREV | TCAGCAGCGTACACCTTCAC | 64.1 | ||||
| GADPH | RTGADPHFOR | TGCACCACCAACTGCTTAG | 62.5 | 201 | DQ403053.1, 397-597 | Uno et al., 2002 PMID 12068078 |
| RTGADPHREV | GGATGCAGGGATGATGTTC | 63.0 | ||||
| Note: GADPHFOR and REV maybe mixed up | . | . | . | . |
Primers for Real-Time PCR
Looked at primers from Yamamoto et al. 2008 PMID 17957211 using Applied Biosystems, but ended up designing own primers above.