NMDA Receptors

Primers for Davenport's Real-Time PCR experiment

Primers were ordered 2009 May from Sigma Aldrich

(designed using PrimerPlus3)

Probe	Abbr	Sequence	Tm	Size	Genbank	Reference
Rat NR1 subunit	QNR1FOR	ttcacagaagtgcgatctgg	60.0	108	U11418.1,2360-2467	PrimerPlus
	QNR1REV	atggacagggaaacgttctg	60.0
Rat Serine Racemase	QSERRACFOR	tggtagatgcgttggtggta	60.0	103	NM_198757, 856-958	PrimerPlus
	QSERRACREV	tcagcagcgtacaccttcac	60.1
Rat GADPH	QGADPHFOR	tcactgccactcagaagactg	60	123	DQ403053, 467-589	Andre designed with sequencher
	QGADPHREV	ggatgaccttgcccacagc	60	.	.	.

Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).

Probe	Abbr	Sequence	Tm	Size	Genbank	Reference
NR1	RTNR1FOR	GTTCTTCCGCTCAGGCTTTG	66.0	66	RNU11418, 2396-2461	Yamamoto et al. 2008 PMID 17957211
	RTNR1REV	AGGGAAACGTTCTGCTTCCA	65.8
Serine Racemase	RTSERRACFOR	ATTGCAAGAAACTGGCCATC	63.9	295	NM198757, 664-958	Yoshikawa et al., 2006 PMID 16973158
	RTSERRACREV	TCAGCAGCGTACACCTTCAC	64.1
GADPH	RTGADPHFOR	TGCACCACCAACTGCTTAG	62.5	201	DQ403053.1, 397-597	Uno et al., 2002 PMID 12068078
	RTGADPHREV	GGATGCAGGGATGATGTTC	63.0
		Note: GADPHFOR and REV maybe mixed up	.	.	.	.

Primers for Real-Time PCR

Looked at primers from Yamamoto et al. 2008 PMID 17957211 using Applied Biosystems, but ended up designing own primers above.