Primers for Davenport's Real-Time PCR experiment
Primers were ordered 2009 May from Sigma Aldrich
(designed using PrimerPlus3)
Probe Abbr Sequence Tm Size Genbank Reference |
---|
Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus |
QNR1REV atggacagggaaacgttctg 60.0 |
Rat Serine Racemase QSERRACFOR tggtagatgcgttggtggta 60.0 103 NM_198757, 856-958 PrimerPlus |
QSERRACREV tcagcagcgtacaccttcac 60.1 |
Rat GADPH QGADPHFOR tcactgccactcagaagactg 60 ??? Andre designed with sequencher |
QGADPHREV ggatgaccttgcccacagc 60 . . . |
Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).
Probe Abbr Sequence Tm Size Genbank Reference |
---|
NR1 RTNR1FOR GTTCTTCCGCTCAGGCTTTG 66.0 66 RNU11418, 2396-2461 Yamamoto et al. 2008 PMID 17957211 |
RTNR1REV AGGGAAACGTTCTGCTTCCA 65.8 |
Serine Racemase RTSERRACFOR ATTGCAAGAAACTGGCCATC 63.9 295 NM198757, 664-958 Yoshikawa et al., 2006 PMID 16973158 |
RTSERRACREV TCAGCAGCGTACACCTTCAC 64.1 |
GADPH RTGADPHFOR TGCACCACCAACTGCTTAG 62.5 201 DQ403053.1, 397-597 Uno et al., 2002 PMID 12068078 |
RTGADPHREV GGATGCAGGGATGATGTTC 63.0 |
Note: GADPHFOR and REV maybe mixed up . . . . |
Primers for Real-Time PCR
Looked at primers from Yamamoto et al. 2008 PMID 17957211 using Applied Biosystems, but ended up designing own primers above.