1,114
edits
Changes
Jump to navigation
Jump to search
no edit summary
Line 1:
Line 1:
Luteinizing hormone/choriogonadotropin receptor (Lhcgr)
Luteinizing hormone/choriogonadotropin receptor (Lhcgr)
+Entrez gene: 25477
Line 7:
Line 8:
LOCUS NM_012978, 2902 bp, mRNA
LOCUS NM_012978, 2902 bp, mRNA
+
+[http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
Line 27:
Line 30:
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
+
+==UCSC Genome Browser Results==
+
+2011-9-16
+
+Searched for lhcgr gene in Feb 2008 GP genome
+
+mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1
+
+[http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)]
+]
+
+Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic
+ scaffold, RGSC_v3.4., which contains LH/CGR precursor
+
+==Primer Design==
+
+Used rat Lhcgr NM_012978 coding region (bases 44-2146) into [http://frodo.wi.mit.edu/primer3/ Primer 3 v. 0.4.0] for products 800-1000 bp
+
+<tab sep=tab border=1 head=top>
+ID Primer Tm
+LHFOR510 gaatgctttccaagggatga 60
+LHRFOR960 ttattccgccatctttgagg 60
+LHFOR1018 tgttcacccaagacactcca 60
+LHREV1426 cagcataggtgatggtgtgc 60
+LHREV1786 ccgagatggcaaagaaagag 60
+LHRREV1872 tggattggcacaagaattga 60
+LHRREV1910 tctctctgaaacgccttcgt 60
+</tab>
+
+
+Primers from Apaja et al. 2003 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
+:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
+:LHRREV2116 ctgttgacagtgcactgtggacaacttcag