1,106
edits
Changes
Jump to navigation
Jump to search
Line 1:
Line 1: + Line 7:
Line 8: + + Line 27:
Line 30: + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
no edit summary
Luteinizing hormone/choriogonadotropin receptor (Lhcgr)
Luteinizing hormone/choriogonadotropin receptor (Lhcgr)
Entrez gene: 25477
LOCUS NM_012978, 2902 bp, mRNA
LOCUS NM_012978, 2902 bp, mRNA
[http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
==UCSC Genome Browser Results==
2011-9-16
Searched for lhcgr gene in Feb 2008 GP genome
mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1
[http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)]
]
Blasted predicted RNA sequence of scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic
scaffold, RGSC_v3.4., which contains LH/CGR precursor
==Primer Design==
Used rat Lhcgr NM_012978 coding region (bases 44-2146) into [http://frodo.wi.mit.edu/primer3/ Primer 3 v. 0.4.0] for products 800-1000 bp
<tab sep=tab border=1 head=top>
ID Primer Tm
LHFOR510 gaatgctttccaagggatga 60
LHRFOR960 ttattccgccatctttgagg 60
LHFOR1018 tgttcacccaagacactcca 60
LHREV1426 cagcataggtgatggtgtgc 60
LHREV1786 ccgagatggcaaagaaagag 60
LHRREV1872 tggattggcacaagaattga 60
LHRREV1910 tctctctgaaacgccttcgt 60
</tab>
Primers from Apaja et al. 2003 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag