Changes

Jump to navigation Jump to search
1,368 bytes added ,  11:18, 16 September 2011
no edit summary
Line 1: Line 1:  
Luteinizing hormone/choriogonadotropin receptor (Lhcgr)
 
Luteinizing hormone/choriogonadotropin receptor (Lhcgr)
 +
Entrez gene: 25477
      Line 7: Line 8:     
LOCUS NM_012978, 2902 bp, mRNA   
 
LOCUS NM_012978, 2902 bp, mRNA   
 +
 +
[http://www.ncbi.nlm.nih.gov/nuccore/M26199 M26199] Rat lutropin-choriogonadotropic hormone receptor mRNA, complete cds
    
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
 
[http://www.ncbi.nlm.nih.gov/nuccore/AH004953.2 AH004953] Rattus norvegicus luteinizing hormone receptor gene, partial cds
Line 27: Line 30:     
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
 
Poor match to AAKN02023989.1 Cavia porcellus strain inbred line 2N cont2.23988, whole genome shotgun sequence
 +
 +
==UCSC Genome Browser Results==
 +
 +
2011-9-16
 +
 +
Searched for lhcgr gene in Feb 2008 GP genome
 +
 +
mRNA/Genomic Alignment of scaffold_18:32322873-32386063 to NM_019978 with 85% identify; Gene Symbol: scaffold_18.245.1
 +
 +
[http://genome.ucsc.edu/cgi-bin/hgc?hgsid=212050989&o=32322824&t=32386408&g=nscanGene&i=scaffold_18.245.1 N-SCAN Gene Predictions (scaffold_18.245.1)]
 +
]
 +
 +
Blasted predicted RNA sequence of  scaffold_18.245.1: Gave good match to NW_047755, Rattus norvegicus strain BN/SsNHsdMCW chromosome 6 genomic
 +
            scaffold, RGSC_v3.4., which contains LH/CGR precursor
 +
 +
==Primer Design==
 +
 +
Used rat Lhcgr NM_012978 coding region (bases 44-2146) into [http://frodo.wi.mit.edu/primer3/ Primer 3 v. 0.4.0] for products 800-1000 bp
 +
 +
<tab sep=tab border=1 head=top>
 +
ID Primer Tm
 +
LHFOR510 gaatgctttccaagggatga 60
 +
LHRFOR960 ttattccgccatctttgagg 60
 +
LHFOR1018 tgttcacccaagacactcca 60
 +
LHREV1426 cagcataggtgatggtgtgc 60
 +
LHREV1786 ccgagatggcaaagaaagag 60
 +
LHRREV1872 tggattggcacaagaattga 60
 +
LHRREV1910 tctctctgaaacgccttcgt 60
 +
</tab>
 +
 +
 +
Primers from Apaja et al. 2003 based on M26199 (forward -29 to +9 of coding, reverse 2116 to 2084 of coding)
 +
:LHRFOR-27 gggagctcacactcaggctggcgggccatggggcgg
 +
:LHRREV2116 ctgttgacagtgcactgtggacaacttcag

Navigation menu