Changes

135 bytes added ,  12:57, 24 September 2007
no edit summary
Line 1: Line 1: −
  −
   
I am interested in 4 of the genes related to serotonin function in depression and food intake:
 
I am interested in 4 of the genes related to serotonin function in depression and food intake:
   Line 14: Line 12:  
=PCR primers=
 
=PCR primers=
   −
Tryptophan Hydroxylase 2 cDNA for in situ hybridization
+
==Tryptophan Hydroxylase 2 cDNA==
 +
 
 +
for in situ hybridization
    
product size:  bp, range & ascension number?
 
product size:  bp, range & ascension number?
   −
TPH2for GAAGTTGGCGGGCTGGTGAGA 21 bases
+
:TPH2for: 5’ -GAAGTTGGCGGGCTGGTGAGA–3’
TPH2rev TCGGCAAGCATGAGTGGGGTAGA 23 bases
+
 
 +
:TPH2rev: 5’ -TCGGCAAGCATGAGTGGGGTAGA–3’
    
Reference: Kulikov AV, Osipova DV, Naumenko VS, Popova NK. Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav. 2005 Nov;4(8):482-5. PMID 16268992
 
Reference: Kulikov AV, Osipova DV, Naumenko VS, Popova NK. Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav. 2005 Nov;4(8):482-5. PMID 16268992
   −
Tryptophan Hydroxylase 2 polymorphism linked to aggression
+
==Tryptophan Hydroxylase 2 polymorphisms==
 +
 
 +
linked to aggression.  5 min at 94°C then 40 cycles (30 s at 94°C, 30 s at 60°C, 30 s at 72°C)
    
Positive control, product size 523 bp
 
Positive control, product size 523 bp
ctrlTPH2for: 5’ -tttgacccaaagacgacctgcttgca –3’
  −
ctrlTPH2rev: 5’-tgcatgcttactagccaaccatgagaca-3’
     −
1473C allele: 307bp
+
:ctrlTPH2for: 5’ -tttgacccaaagacgacctgcttgca –3’
 +
 
 +
:ctrlTPH2rev: 5’-tgcatgcttactagccaaccatgagaca-3’
 +
 
 +
:1473C allele, product size 307bp
 +
 
 
TPH2C1473: 5’-cagaatttcaatgctctgcgtgtggg-3’
 
TPH2C1473: 5’-cagaatttcaatgctctgcgtgtggg-3’
   −
1473G allele : 307 bp
+
:1473G allele. product size 307 bp
 +
 
 
TPH2g1473: 5’-cagaatttcaatgctctgcgtgtggc-3’
 
TPH2g1473: 5’-cagaatttcaatgctctgcgtgtggc-3’
    
Reference:  Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG. Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science. 2004 Jul 9;305(5681):217. PMID 15247473
 
Reference:  Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG. Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science. 2004 Jul 9;305(5681):217. PMID 15247473