| Line 1: |
Line 1: |
| − |
| |
| − |
| |
| | I am interested in 4 of the genes related to serotonin function in depression and food intake: | | I am interested in 4 of the genes related to serotonin function in depression and food intake: |
| | | | |
| Line 14: |
Line 12: |
| | =PCR primers= | | =PCR primers= |
| | | | |
| − | Tryptophan Hydroxylase 2 cDNA for in situ hybridization | + | ==Tryptophan Hydroxylase 2 cDNA== |
| | + | |
| | + | for in situ hybridization |
| | | | |
| | product size: bp, range & ascension number? | | product size: bp, range & ascension number? |
| | | | |
| − | TPH2for GAAGTTGGCGGGCTGGTGAGA 21 bases | + | :TPH2for: 5’ -GAAGTTGGCGGGCTGGTGAGA–3’ |
| − | TPH2rev TCGGCAAGCATGAGTGGGGTAGA 23 bases | + | |
| | + | :TPH2rev: 5’ -TCGGCAAGCATGAGTGGGGTAGA–3’ |
| | | | |
| | Reference: Kulikov AV, Osipova DV, Naumenko VS, Popova NK. Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav. 2005 Nov;4(8):482-5. PMID 16268992 | | Reference: Kulikov AV, Osipova DV, Naumenko VS, Popova NK. Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav. 2005 Nov;4(8):482-5. PMID 16268992 |
| | | | |
| − | Tryptophan Hydroxylase 2 polymorphism linked to aggression | + | ==Tryptophan Hydroxylase 2 polymorphisms== |
| | + | |
| | + | linked to aggression. 5 min at 94°C then 40 cycles (30 s at 94°C, 30 s at 60°C, 30 s at 72°C) |
| | | | |
| | Positive control, product size 523 bp | | Positive control, product size 523 bp |
| − | ctrlTPH2for: 5’ -tttgacccaaagacgacctgcttgca –3’
| |
| − | ctrlTPH2rev: 5’-tgcatgcttactagccaaccatgagaca-3’
| |
| | | | |
| − | 1473C allele: 307bp | + | :ctrlTPH2for: 5’ -tttgacccaaagacgacctgcttgca –3’ |
| | + | |
| | + | :ctrlTPH2rev: 5’-tgcatgcttactagccaaccatgagaca-3’ |
| | + | |
| | + | :1473C allele, product size 307bp |
| | + | |
| | TPH2C1473: 5’-cagaatttcaatgctctgcgtgtggg-3’ | | TPH2C1473: 5’-cagaatttcaatgctctgcgtgtggg-3’ |
| | | | |
| − | 1473G allele : 307 bp | + | :1473G allele. product size 307 bp |
| | + | |
| | TPH2g1473: 5’-cagaatttcaatgctctgcgtgtggc-3’ | | TPH2g1473: 5’-cagaatttcaatgctctgcgtgtggc-3’ |
| | | | |
| | Reference: Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG. Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science. 2004 Jul 9;305(5681):217. PMID 15247473 | | Reference: Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG. Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science. 2004 Jul 9;305(5681):217. PMID 15247473 |