1,044
edits
Changes
added some more primer info
'''From Li et al PMID 19244510'''
'''From Li et al PMID 19244510'''
PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp.
PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp.
:WORKED WELL at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
'''Rat SIK1 from Kanyo et al PMID 19470703'''
'''Rat SIK1 from Kanyo et al PMID 19470703'''
Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
: DID NOT WORK IN OUR HANDS at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
'''Rat SIK2 primers based on Mouse SIK2 from Horike PMID 12624099'''
forward primer: CATGGTCATGGCGGATGGCCCGAGGCA ( rat DQ188032.1 bp45-71) and reverse: CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC (mouse 178710.3 bp 2941-2994) Predicted product 2449 bp.
:DID NOT WORK IN OUR HANDS AT: at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
===Other SIK primers Not Used===
'''Rat SIK1 from Lin et al PMID 11463852'''
'''Rat SIK1 from Lin et al PMID 11463852'''
'''Mouse SIK1 from Horike et al PMID 12624099'''
'''Mouse SIK1 from Horike et al PMID 12624099'''
a 3′ non-coding region of mouse SIK1 cDNA was amplified by PCR by using primers, 5′-TTGCTCATGCCTGTGTAGTG and 5′-TTCGCCTGTCTGGAGAGTAA.
(NOT USED) a 3′ non-coding region of mouse SIK1 cDNA was amplified by PCR by using primers, 5′-TTGCTCATGCCTGTGTAGTG and 5′-TTCGCCTGTCTGGAGAGTAA.
'''Mouse SIK2 from Horike et al PMID 12624099'''
'''Mouse SIK2 from Horike et al PMID 12624099'''
Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).
(NOT USED) Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).
Wang et al 1999 PMID 10403390
First paper cloning SIK (SIK I?) from rat adrenal cortex
5'-ATGGTGATCATGTCGGAGTTC-3′ , 5'-TTATCATTGAGGTCCTCAG-3′ product 2.4 Kb