Changes

'''From Li et al PMID 19244510'''

'''From Li et al PMID 19244510'''

PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′; reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′)  

PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp.

'''Rat SIK1 from Kanyo et al PMID 19470703'''

'''Rat SIK1 from Kanyo et al PMID 19470703'''

Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.  

Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.  

'''Rat SIK1 from Lin et al PMID 11463852'''

'''Rat SIK1 from Lin et al PMID 11463852'''

SIK cDNA fragments were amplified by PCR from a rat adrenal zona glomerulosa cDNA library (15) by using the following sets of primer, sense: 5′-gcggccgcATGGTGATCATGTCGGAGTTC and antisense1: 5′-gaattcTCACTGTACCAGGACGAACGTCC, or sense and antisense2: 5′-gaattcCTGTACCAGGACGAACGTCCC (the lowercase letters indicate the linker sequences). The amplified products were introduced into pT7(R) vector (Novagen), the resultant plasmids being named pT7-SIK and pT7-SIK(-stop),  

(NOT USED) SIK cDNA fragments were amplified by PCR from a rat adrenal zona glomerulosa cDNA library (15) by using the following sets of primer, sense: 5′-gcggccgcATGGTGATCATGTCGGAGTTC and antisense1: 5′-gaattcTCACTGTACCAGGACGAACGTCC, or sense and antisense2: 5′-gaattcCTGTACCAGGACGAACGTCCC (the lowercase letters indicate the linker sequences). The amplified products were introduced into pT7(R) vector (Novagen), the resultant plasmids being named pT7-SIK and pT7-SIK(-stop),  

'''Mouse SIK1 from Horike et al  PMID 12624099'''

'''Mouse SIK1 from Horike et al  PMID 12624099'''

Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).

Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).