1,114
edits
Changes
Jump to navigation
Jump to search
added some more primer info
Line 26:
Line 26:
'''Rat SIK2 primers based on Mouse SIK2 from Horike'''
−forward primer: CATGGTCATGGCGGATGGCCCGAGGCA ( rat DQ188032.1 bp45-71) and reverse: CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC (mouse 178710.3 bp 2941-2994) Predicted product 2449 bp.+
+
'''From Li et al PMID 19244510'''
'''From Li et al PMID 19244510'''
−PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp.
+PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp.
+:WORKED WELL at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
'''Rat SIK1 from Kanyo et al PMID 19470703'''
'''Rat SIK1 from Kanyo et al PMID 19470703'''
Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
+: DID NOT WORK IN OUR HANDS at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
+
+'''Rat SIK2 primers based on Mouse SIK2 from Horike PMID 12624099'''
+
+forward primer: CATGGTCATGGCGGATGGCCCGAGGCA ( rat DQ188032.1 bp45-71) and reverse: CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC (mouse 178710.3 bp 2941-2994) Predicted product 2449 bp.
+:DID NOT WORK IN OUR HANDS AT: at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
+
+
+===Other SIK primers Not Used===
'''Rat SIK1 from Lin et al PMID 11463852'''
'''Rat SIK1 from Lin et al PMID 11463852'''
Line 38:
Line 48:
'''Mouse SIK1 from Horike et al PMID 12624099'''
'''Mouse SIK1 from Horike et al PMID 12624099'''
−a 3′ non-coding region of mouse SIK1 cDNA was amplified by PCR by using primers, 5′-TTGCTCATGCCTGTGTAGTG and 5′-TTCGCCTGTCTGGAGAGTAA.
+(NOT USED) a 3′ non-coding region of mouse SIK1 cDNA was amplified by PCR by using primers, 5′-TTGCTCATGCCTGTGTAGTG and 5′-TTCGCCTGTCTGGAGAGTAA.
'''Mouse SIK2 from Horike et al PMID 12624099'''
'''Mouse SIK2 from Horike et al PMID 12624099'''
−Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).
+(NOT USED) Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).
−Wang et al 1999 PMID 10403390
+First paper cloning SIK (SIK I?) from rat adrenal cortex
+5'-ATGGTGATCATGTCGGAGTTC-3′ , 5'-TTATCATTGAGGTCCTCAG-3′ product 2.4 Kb