| Line 26: |
Line 26: |
| | '''From Li et al PMID 19244510''' | | '''From Li et al PMID 19244510''' |
| | | | |
| − | PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp. | + | PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp. |
| | + | :WORKED WELL at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min. |
| | | | |
| | '''Rat SIK1 from Kanyo et al PMID 19470703''' | | '''Rat SIK1 from Kanyo et al PMID 19470703''' |
| | | | |
| | Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min. | | Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min. |
| | + | : DID NOT WORK IN OUR HANDS at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min. |
| | + | |
| | + | '''Rat SIK2 primers based on Mouse SIK2 from Horike PMID 12624099''' |
| | + | |
| | + | forward primer: CATGGTCATGGCGGATGGCCCGAGGCA ( rat DQ188032.1 bp45-71) and reverse: CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC (mouse 178710.3 bp 2941-2994) Predicted product 2449 bp. |
| | + | :DID NOT WORK IN OUR HANDS AT: at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min. |
| | + | |
| | + | |
| | + | ===Other SIK primers Not Used=== |
| | | | |
| | '''Rat SIK1 from Lin et al PMID 11463852''' | | '''Rat SIK1 from Lin et al PMID 11463852''' |
| Line 38: |
Line 48: |
| | '''Mouse SIK1 from Horike et al PMID 12624099''' | | '''Mouse SIK1 from Horike et al PMID 12624099''' |
| | | | |
| − | a 3′ non-coding region of mouse SIK1 cDNA was amplified by PCR by using primers, 5′-TTGCTCATGCCTGTGTAGTG and 5′-TTCGCCTGTCTGGAGAGTAA. | + | (NOT USED) a 3′ non-coding region of mouse SIK1 cDNA was amplified by PCR by using primers, 5′-TTGCTCATGCCTGTGTAGTG and 5′-TTCGCCTGTCTGGAGAGTAA. |
| | | | |
| | '''Mouse SIK2 from Horike et al PMID 12624099''' | | '''Mouse SIK2 from Horike et al PMID 12624099''' |
| | | | |
| − | Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC). | + | (NOT USED) Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC). |
| | | | |
| − | '''Rat SIK2 primers based on Mouse SIK2 from Horike'''
| |
| | | | |
| − | forward primer: CATGGTCATGGCGGATGGCCCGAGGCA ( rat DQ188032.1 bp45-71) and reverse: CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC (mouse 178710.3 bp 2941-2994) Predicted product 2449 bp.
| + | Wang et al 1999 PMID 10403390 |
| | + | |
| | + | First paper cloning SIK (SIK I?) from rat adrenal cortex |
| | + | 5'-ATGGTGATCATGTCGGAGTTC-3′ , 5'-TTATCATTGAGGTCCTCAG-3′ product 2.4 Kb |