1,145
edits
Changes
Jump to navigation
Jump to search
Line 1:
Line 1: + + Line 7:
Line 9: − '''Antisera from Cell Signaling'''+ Line 18:
Line 20: + + + + + + + + + + + + + + + + + + + + + + +
added primers
==Description==
TORC proteins (aka CREB-regulated transcription coactivators or CRTCs) are a family of 3 highly-conserved human genes identified in high-throughput screens of cDNAs that activated the IL-8 promoter {Iourgenko, 2003 #1935} or a CRE-containing reporter construct {Conkright, 2003 #1936}. All 3 TORCs are expressed in the brain, with highest expression of TORC1 {Altarejos, 2008 #1938}. TORCs do not bind DNA directly, but are CREB co-activators that enhance CRE-regulated transcription after binding CREB and recruiting TFIID {Iourgenko, 2003 #1935}{Conkright, 2003 #1936}.
TORC proteins (aka CREB-regulated transcription coactivators or CRTCs) are a family of 3 highly-conserved human genes identified in high-throughput screens of cDNAs that activated the IL-8 promoter {Iourgenko, 2003 #1935} or a CRE-containing reporter construct {Conkright, 2003 #1936}. All 3 TORCs are expressed in the brain, with highest expression of TORC1 {Altarejos, 2008 #1938}. TORCs do not bind DNA directly, but are CREB co-activators that enhance CRE-regulated transcription after binding CREB and recruiting TFIID {Iourgenko, 2003 #1935}{Conkright, 2003 #1936}.
==Antisera from Cell Signaling==
Torc1 (C71D11) Rabbit mAb #2587 $225 http://www.cellsignal.com/products/2587.html (Dilution of 1:1000 looks best in our hands).
Torc1 (C71D11) Rabbit mAb #2587 $225 http://www.cellsignal.com/products/2587.html (Dilution of 1:1000 looks best in our hands).
Phospho-CREB (Ser133) (1B6) Mouse mAb #9196S $235 http://www.cellsignal.com/products/9196.html
Phospho-CREB (Ser133) (1B6) Mouse mAb #9196S $235 http://www.cellsignal.com/products/9196.html
==Torc related PCR primers==
'''From Li et al PMID 19244510'''
PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′; reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′)
'''Rat SIK1 from Kanyo et al PMID 19470703'''
Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.
'''Rat SIK1 from Lin et al PMID 11463852'''
SIK cDNA fragments were amplified by PCR from a rat adrenal zona glomerulosa cDNA library (15) by using the following sets of primer, sense: 5′-gcggccgcATGGTGATCATGTCGGAGTTC and antisense1: 5′-gaattcTCACTGTACCAGGACGAACGTCC, or sense and antisense2: 5′-gaattcCTGTACCAGGACGAACGTCCC (the lowercase letters indicate the linker sequences). The amplified products were introduced into pT7(R) vector (Novagen), the resultant plasmids being named pT7-SIK and pT7-SIK(-stop),
'''Mouse SIK1 from Horike et al PMID 12624099'''
a 3′ non-coding region of mouse SIK1 cDNA was amplified by PCR by using primers, 5′-TTGCTCATGCCTGTGTAGTG and 5′-TTCGCCTGTCTGGAGAGTAA.
'''Mouse SIK2 from Horike et al PMID 12624099'''
Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).