493
edits
Changes
Jump to navigation
Jump to search
Fix table to use tabs.
Line 6:
Line 6:
−
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
+<tab class="wikitable" sep=tab border = "1" cellspacing="3" cellpadding = "3" head = top>
Probe Abbr Sequence Tm Size Genbank Reference
Probe Abbr Sequence Tm Size Genbank Reference
Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus
Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus
Line 21:
Line 21:
Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).
Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).
−<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
+<tab class="wikitable" sep=tab border = "1" cellspacing="3" cellpadding = "3" head = top>
Probe Abbr Sequence Tm Size Genbank Reference
Probe Abbr Sequence Tm Size Genbank Reference
NR1 RTNR1FOR GTTCTTCCGCTCAGGCTTTG 66.0 66 RNU11418, 2396-2461 Yamamoto et al. 2008 PMID 17957211
NR1 RTNR1FOR GTTCTTCCGCTCAGGCTTTG 66.0 66 RNU11418, 2396-2461 Yamamoto et al. 2008 PMID 17957211