1,114
edits
Changes
→Primers for Davenport's Real-Time PCR experiment: added new primers designed in May 2009
Line 1:
Line 1:
+
+
+
+
+
=Primers for Davenport's Real-Time PCR experiment=
=Primers for Davenport's Real-Time PCR experiment=
−Primers were ordered 2009 March from Sigma Aldrich
+Primers were ordered 2009 May from Sigma Aldrich
+<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
+Probe Abbr Sequence Tm Size Genbank Reference
+Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus
+ QNR1REV atggacagggaaacgttctg 60.0
+Rat Serine Racemase QSERRACFOR tggtagatgcgttggtggta 60.0 103 NM_198757, 856-958 PrimerPlus
+ QSERRACREV tcagcagcgtacaccttcac 60.1
+Rat GADPH QGADPHFOR tcactgccactcagaagactg 60 ??? Andre designed with sequencher
+ QGADPHREV ggatgaccttgcccacagc 60 . . .
+</tab>
+Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
Line 13:
Line 28:
Note: GADPHFOR and REV maybe mixed up . . . .
Note: GADPHFOR and REV maybe mixed up . . . .
</tab>
</tab>
−=Primers for Real-Time PCR=
=Primers for Real-Time PCR=