Changes

Jump to navigation Jump to search
758 bytes added ,  15:06, 23 May 2009
→‎Primers for Davenport's Real-Time PCR experiment: added new primers designed in May 2009
Line 1: Line 1:  
=Primers for Davenport's Real-Time PCR experiment=
 
=Primers for Davenport's Real-Time PCR experiment=
   −
Primers were ordered 2009 March from Sigma Aldrich
+
Primers were ordered 2009 May from Sigma Aldrich
 +
 
 +
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
 +
Probe Abbr Sequence Tm Size Genbank Reference
 +
Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus
 +
QNR1REV atggacagggaaacgttctg 60.0
 +
 
 +
Rat Serine Racemase QSERRACFOR tggtagatgcgttggtggta 60.0 103 NM_198757, 856-958 PrimerPlus
 +
QSERRACREV tcagcagcgtacaccttcac 60.1
 +
 
 +
Rat GADPH QGADPHFOR tcactgccactcagaagactg 60 ??? Andre designed with sequencher
 +
QGADPHREV ggatgaccttgcccacagc 60 . . .
 +
 
 +
</tab>
 +
 
 +
Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).
    
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
 
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
Line 13: Line 28:  
Note: GADPHFOR and REV maybe mixed up . . . .
 
Note: GADPHFOR and REV maybe mixed up . . . .
 
</tab>
 
</tab>
  −
  −
  −
  −
      
=Primers for Real-Time PCR=
 
=Primers for Real-Time PCR=

Navigation menu