1,093
edits
Changes
Jump to navigation
Jump to search
Line 1:
Line 1: − + + + + + + + + + + + + + + + + Line 13:
Line 28: − − − − −
→Primers for Davenport's Real-Time PCR experiment: added new primers designed in May 2009
=Primers for Davenport's Real-Time PCR experiment=
=Primers for Davenport's Real-Time PCR experiment=
Primers were ordered 2009 March from Sigma Aldrich
Primers were ordered 2009 May from Sigma Aldrich
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
Probe Abbr Sequence Tm Size Genbank Reference
Rat NR1 subunit QNR1FOR ttcacagaagtgcgatctgg 60.0 108 U11418.1,2360-2467 PrimerPlus
QNR1REV atggacagggaaacgttctg 60.0
Rat Serine Racemase QSERRACFOR tggtagatgcgttggtggta 60.0 103 NM_198757, 856-958 PrimerPlus
QSERRACREV tcagcagcgtacaccttcac 60.1
Rat GADPH QGADPHFOR tcactgccactcagaagactg 60 ??? Andre designed with sequencher
QGADPHREV ggatgaccttgcccacagc 60 . . .
</tab>
Primers were ordered 2009 March from Sigma Aldrich (NB: these primers worked fine in a test RT-PCR, but Andre said the product sizes should be 100-150bp, and the Tm's should be closer together. So, we redesigned and ordered primers above).
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
<tab class="wikitable" border = "1" cellspacing="3" cellpadding = "3" head = top>
Note: GADPHFOR and REV maybe mixed up . . . .
Note: GADPHFOR and REV maybe mixed up . . . .
</tab>
</tab>
=Primers for Real-Time PCR=
=Primers for Real-Time PCR=