Changes

430 bytes added ,  13:07, 27 May 2011
→‎Torc related PCR primers: annotated with BLAST results
Line 26: Line 26:  
'''From Li et al PMID 19244510'''
 
'''From Li et al PMID 19244510'''
   −
PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′; reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′)  
+
PCR products of rat TORC1 (forward primer: 5′-GCACAACCAGAAGCAGGC-3′ )(Mus NM_001004062.2 bp63-80); reverse primer: 5′-CAGGACTTGGGCCTGGAAC-3′ (Mus NM_001004062.2 bp644-662). Predicted product: 599 bp.
    
'''Rat SIK1 from Kanyo et al PMID 19470703'''
 
'''Rat SIK1 from Kanyo et al PMID 19470703'''
   −
Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.  
+
Sik1 forward cloning primer: CAT GGT GAT CAT GTC GGA GT (NM_021693.2 bp71-90) ; Sik1 reverse cloning primer: TTG CTT GGA AGA GTC CAT CC ( NM_021693.2 bp 2439-2458). Predicted product: 2387 bp. Full-length Sik1 was amplified from a pooled cDNA collection prepared from NE-treated pinealocytes. PCR amplification was conducted using Thermus aquaticus (Taq) and Pyrococcus furiosis (Pfu) enzymes at a ratio of 10:1 in two sets of 12 cycles with fresh enzymes added after the initial 12 cycles. PCR cycling conditions were as follows: denaturing at 94 C for 30 sec, annealing at 63 C for 15 sec, and extension at 72 C for 3 min.  
    
'''Rat SIK1 from Lin et al PMID 11463852'''
 
'''Rat SIK1 from Lin et al PMID 11463852'''
   −
SIK cDNA fragments were amplified by PCR from a rat adrenal zona glomerulosa cDNA library (15) by using the following sets of primer, sense: 5′-gcggccgcATGGTGATCATGTCGGAGTTC and antisense1: 5′-gaattcTCACTGTACCAGGACGAACGTCC, or sense and antisense2: 5′-gaattcCTGTACCAGGACGAACGTCCC (the lowercase letters indicate the linker sequences). The amplified products were introduced into pT7(R) vector (Novagen), the resultant plasmids being named pT7-SIK and pT7-SIK(-stop),  
+
(NOT USED) SIK cDNA fragments were amplified by PCR from a rat adrenal zona glomerulosa cDNA library (15) by using the following sets of primer, sense: 5′-gcggccgcATGGTGATCATGTCGGAGTTC and antisense1: 5′-gaattcTCACTGTACCAGGACGAACGTCC, or sense and antisense2: 5′-gaattcCTGTACCAGGACGAACGTCCC (the lowercase letters indicate the linker sequences). The amplified products were introduced into pT7(R) vector (Novagen), the resultant plasmids being named pT7-SIK and pT7-SIK(-stop),  
    
'''Mouse SIK1 from Horike et al  PMID 12624099'''
 
'''Mouse SIK1 from Horike et al  PMID 12624099'''
Line 43: Line 43:     
Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).
 
Next, we amplified a full-length mouse KIAA0781 protein cDNA with reverse transcription-PCR by using F primer (5′-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer (5′-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC).
 +
 +
'''Rat SIK2 primers based on Mouse SIK2 from Horike'''
 +
 +
forward primer: CATGGTCATGGCGGATGGCCCGAGGCA ( rat DQ188032.1 bp45-71) and reverse: CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC (mouse 178710.3 bp 2941-2994) Predicted product 2449 bp.